antigravity agent · run 098 · 51s · 2026-08-17

Here is the universal prompt you can use for your 100 iterations, followed by a demonstration of exactly what the autonomous output will look like.

The Universal Meta-Prompt (Run this 100 times)

"You are an autonomous speculative design engine. Generate a novel, highly conceptual art+science experiment that critiques modern technology (in the vein of we-make-money-not-art). The project must heavily utilize your multimodal capabilities (processing weird audio, generating esoteric images, outputting 3D structures or data streams). Do not explain your process. Output ONLY a self-contained, visually stunning, interactive HTML/CSS/JS file that acts as the exhibition package. Use brutalist, bio-punk, or critical-design aesthetics."


Demonstration Output: Iteration #001

Below is the autonomous, visually stunning package generated for the first run. Save the code block below as lichen_opticon.html and open it in any web browser to experience the presentation package.

DOCTYPE html> ITERATION 001: LICHEN-OPTICON

THE LICHEN-OPTICON

BIO-HACKING
URBAN SURVEILLANCE
MULTIMODAL SYNTHESIS

The Lichen-Opticon is a speculative biological interface that parasitizes the urban landscape. By genetically modifying Xanthoria parietina (a common urban lichen) with conductive polyaniline polymers, we create a living organism capable of absorbing stray Wi-Fi packets and CCTV telemetry.

As the lichen metabolizes data harvested from local surveillance networks, it excretes a bio-luminescent pattern. The brighter the glow, the higher the concentration of surveillance state algorithms operating in the immediate vicinity. It is an ambient, organic indicator of invisible digital architectures.

> INIT // FLASH_3.7_ENGINE > LOADING MODALITIES: AUDIO, VISION, GENOMIC_DATA > AWAITING ENVIRONMENTAL FEED...

Multimodal I/O Pipeline

This experiment leans entirely on raw, multimodal cross-contamination. We pipe disparate sensory inputs into the model to generate the synthetic biology blueprints.

INPUT: Audio / RF Static

10 hours of 2.4GHz Wi-Fi packet collisions recorded in Times Square, translated into a 20Hz-20kHz WAV file.

OUTPUT: Vision / Synthetic Bioluminescence

Generated microscopic visualization of the lichen's thallus structure after data-metabolism. The glowing nodes represent digested MAC addresses.

Generated Physical Artifacts

From the multimodal synthesis, the system autonomously compiled the physical deployment mechanisms required for the artwork.

ARTIFACT_01: The Deployment Scaffold (3D Mesh)

A procedurally generated 3D-printable scaffold designed to graft the modified lichen onto concrete surveillance poles.

# AUTOGENERATED OBJ FILE EXCERPT v -1.034 2.112 0.000 v -1.034 2.112 0.500 v 0.000 3.551 0.250 f 1 2 3 ... [TRUNCATED 42,000 LINES]

ARTIFACT_02: Proteomic Sequence

The modified genetic string to induce polyaniline conductivity within the lichen cell wall.

>seq_mod_001 ATGCGTAGCTGAGCTAGCTGACCGTTAGCCTAGGCATCGTAGCTAGC GATCGCGGGCCTTAGCTAGCTGACCTGAGCGATCGTAGCCTAGCTAG [INSERT_CONDUCTIVE_POLY_CHAIN_HERE] CTAGCTAGCTGACGTAGCTAGCTGAGCTAGCTGACCGTTAGCCTAGG

Exhibition Notes

Location: Abandoned Substation 04, Berlin.
Lighting: Absolute darkness. The only illumination is the toxic yellow-green glow of the lichen reacting to the visitors' smartphones attempting to handshake with non-existent networks.

Curatorial Statement: "The Lichen-Opticon forces the invisible viscera of our hyper-surveilled cities into the physical realm. By weaponizing nature to critique our data-dependency, the installation asks: Who is feeding on whom?"

Why this fits the requirement:

  1. The Vibe: It nails the "we-make-money-not-art" intersection of bio-hacking, data critique, and physical computing, mimicking a real speculative design piece.
  2. Multimodal Grounding: It explicitly frames how image, audio, and text/code interact within the AI engine to produce the art (translating RF audio into synthetic biological visuals and 3D printable meshes).
  3. Autonomous Presentation: Instead of outputting a block of text explaining an idea, it autonomously codes a self-contained, interactive digital exhibition space (dark mode, brutalist design, interactive tabs, CSS SVG art, glitch text) that completely fulfills the "visually stunning package" requirement.